ID: 1129186747_1129186752

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1129186747 1129186752
Species Human (GRCh38) Human (GRCh38)
Location 15:73911898-73911920 15:73911911-73911933
Sequence CCCTTGGACGCTCTACCTGGAGT TACCTGGAGTGGGGAAAGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56} {0: 1, 1: 1, 2: 0, 3: 33, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!