ID: 1129188931_1129188936

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1129188931 1129188936
Species Human (GRCh38) Human (GRCh38)
Location 15:73926632-73926654 15:73926654-73926676
Sequence CCGTCCCGCTCGGGACAAGGCCA AGCATGGACAAAGCTAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84} {0: 1, 1: 0, 2: 0, 3: 9, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!