ID: 1129211301_1129211308

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1129211301 1129211308
Species Human (GRCh38) Human (GRCh38)
Location 15:74071619-74071641 15:74071652-74071674
Sequence CCGTCCGCCTTCTCCTTCGGGAG CTGCTCTGGAGCCAAAATAATGG
Strand - +
Off-target summary {0: 4, 1: 1, 2: 1, 3: 6, 4: 184} {0: 5, 1: 9, 2: 9, 3: 20, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!