ID: 1129220252_1129220265

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1129220252 1129220265
Species Human (GRCh38) Human (GRCh38)
Location 15:74128270-74128292 15:74128319-74128341
Sequence CCGGGCGGGCACTGGGCTCTCCA CTTTCCCCCAGGGCAGCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 234} {0: 1, 1: 0, 2: 15, 3: 41, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!