ID: 1129226734_1129226742

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1129226734 1129226742
Species Human (GRCh38) Human (GRCh38)
Location 15:74174587-74174609 15:74174632-74174654
Sequence CCACTCGGAGGAGGAGCTGGGGT CTGCCTGGCTGCGTGACCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 236} {0: 1, 1: 1, 2: 20, 3: 177, 4: 1026}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!