ID: 1129260280_1129260282

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1129260280 1129260282
Species Human (GRCh38) Human (GRCh38)
Location 15:74362982-74363004 15:74363007-74363029
Sequence CCTTCACTCTTCTGAAAGGGCAT TTTGTTAGGTCCTTTTTCCATGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 30, 3: 74, 4: 217} {0: 39, 1: 40, 2: 27, 3: 29, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!