ID: 1129270620_1129270634

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1129270620 1129270634
Species Human (GRCh38) Human (GRCh38)
Location 15:74417558-74417580 15:74417607-74417629
Sequence CCCCCTGGGGCGCCTGCTCCAGC GGAGTTCTCGTCCGGGCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 394} {0: 1, 1: 0, 2: 0, 3: 12, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!