ID: 1129301175_1129301180

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1129301175 1129301180
Species Human (GRCh38) Human (GRCh38)
Location 15:74626399-74626421 15:74626447-74626469
Sequence CCAGGGCTCAGCGCAGTAGGATT GGCTCCTTGGTGAAGTTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77} {0: 1, 1: 0, 2: 0, 3: 15, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!