ID: 1129329787_1129329794

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1129329787 1129329794
Species Human (GRCh38) Human (GRCh38)
Location 15:74821118-74821140 15:74821156-74821178
Sequence CCGGATCCTGCAGGCTCTGCGGG TGGCCCAGGCTGAGAGACAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 219} {0: 1, 1: 0, 2: 3, 3: 50, 4: 1067}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!