ID: 1129332929_1129332938

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1129332929 1129332938
Species Human (GRCh38) Human (GRCh38)
Location 15:74837020-74837042 15:74837058-74837080
Sequence CCAGTATACAGCACAGCCATCAA CAGAGTAACCTGAGGGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118} {0: 1, 1: 0, 2: 1, 3: 38, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!