ID: 1129336304_1129336309

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1129336304 1129336309
Species Human (GRCh38) Human (GRCh38)
Location 15:74854159-74854181 15:74854201-74854223
Sequence CCATTAGCTGGTGACGAGGGGGC TGATGTGCCCCTGCCTGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 55} {0: 1, 1: 0, 2: 3, 3: 18, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!