ID: 1129348214_1129348220

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1129348214 1129348220
Species Human (GRCh38) Human (GRCh38)
Location 15:74937915-74937937 15:74937930-74937952
Sequence CCACGGCGGGGCCGGGGGTCCGG GGGTCCGGGCGGAGTGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 382} {0: 1, 1: 0, 2: 0, 3: 19, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!