ID: 1129382059_1129382063

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1129382059 1129382063
Species Human (GRCh38) Human (GRCh38)
Location 15:75174269-75174291 15:75174285-75174307
Sequence CCTGCCCTGCAACACTGCCACCC GCCACCCTTTGCTCCCTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 424} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!