ID: 1129412538_1129412547

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1129412538 1129412547
Species Human (GRCh38) Human (GRCh38)
Location 15:75358126-75358148 15:75358153-75358175
Sequence CCCAGCCTGTTCCACACAAGCAG CCCAGCCAGGGAGGAGTCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 174} {0: 1, 1: 1, 2: 1, 3: 47, 4: 494}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!