ID: 1129414581_1129414591

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1129414581 1129414591
Species Human (GRCh38) Human (GRCh38)
Location 15:75368239-75368261 15:75368265-75368287
Sequence CCGTTTCCGCCTGGGGGCCAGCT CGGTGGGGCCGCACTTTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 131} {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!