ID: 1129449106_1129449113

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1129449106 1129449113
Species Human (GRCh38) Human (GRCh38)
Location 15:75640042-75640064 15:75640076-75640098
Sequence CCCGCCGCTGCAGCCGGTAACGC CAGCTCGTGCAGGTTGTGGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58} {0: 1, 1: 0, 2: 0, 3: 14, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!