ID: 1129449785_1129449793

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1129449785 1129449793
Species Human (GRCh38) Human (GRCh38)
Location 15:75644746-75644768 15:75644784-75644806
Sequence CCTGGGCAACATAGTGAAAAGCC CAAAAGTTGGCTGGATGTGGTGG
Strand - +
Off-target summary {0: 2, 1: 54, 2: 1800, 3: 27460, 4: 154767} {0: 1, 1: 82, 2: 2391, 3: 25897, 4: 69823}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!