ID: 1129450450_1129450461

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1129450450 1129450461
Species Human (GRCh38) Human (GRCh38)
Location 15:75648330-75648352 15:75648366-75648388
Sequence CCACTTCTGGGGCGGGGAGAGGG GGGGGCTCCGGCTGCGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 178, 4: 2719} {0: 1, 1: 0, 2: 1, 3: 31, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!