ID: 1129456139_1129456144

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1129456139 1129456144
Species Human (GRCh38) Human (GRCh38)
Location 15:75677040-75677062 15:75677053-75677075
Sequence CCCTCACCGTGATGGCAAAGGCC GGCAAAGGCCTCTGAGGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 84} {0: 1, 1: 1, 2: 1, 3: 26, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!