ID: 1129461127_1129461141

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1129461127 1129461141
Species Human (GRCh38) Human (GRCh38)
Location 15:75700546-75700568 15:75700579-75700601
Sequence CCCACTGGTGACTTGGAGGTCTG GGAGAGACAGGGGTCTGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 112} {0: 2, 1: 0, 2: 7, 3: 64, 4: 559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!