ID: 1129463841_1129463856

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1129463841 1129463856
Species Human (GRCh38) Human (GRCh38)
Location 15:75712935-75712957 15:75712958-75712980
Sequence CCCCCACCTGCCCCCACCCTCAA CCTTCTTAAAGGGCCCGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 17, 3: 196, 4: 1929} {0: 1, 1: 0, 2: 1, 3: 5, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!