ID: 1129484863_1129484867

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1129484863 1129484867
Species Human (GRCh38) Human (GRCh38)
Location 15:75860957-75860979 15:75860997-75861019
Sequence CCAGTGTTTGGTTTTTGGAGCCA ATCTTTGTTCTGCTACTTACTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 4, 3: 19, 4: 231} {0: 1, 1: 1, 2: 8, 3: 63, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!