ID: 1129520087_1129520098

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1129520087 1129520098
Species Human (GRCh38) Human (GRCh38)
Location 15:76180385-76180407 15:76180417-76180439
Sequence CCCCTCTGTTGGGATTCGTCTGA CAGGGTAAGCCTGGGGTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 33, 4: 142} {0: 1, 1: 0, 2: 4, 3: 33, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!