ID: 1129523874_1129523882

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1129523874 1129523882
Species Human (GRCh38) Human (GRCh38)
Location 15:76202001-76202023 15:76202021-76202043
Sequence CCAGCACCCAGTGCAGTCCAGCC GCCCCTGGGGCAGGTGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 322} {0: 1, 1: 0, 2: 3, 3: 50, 4: 574}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!