ID: 1129524381_1129524392

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1129524381 1129524392
Species Human (GRCh38) Human (GRCh38)
Location 15:76204579-76204601 15:76204598-76204620
Sequence CCAGCCTGTGGCCCAGCTTCAGC CAGCAGGGTAGAGTGTGGGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 51, 4: 374} {0: 1, 1: 0, 2: 1, 3: 49, 4: 522}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!