ID: 1129556432_1129556433

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1129556432 1129556433
Species Human (GRCh38) Human (GRCh38)
Location 15:76515070-76515092 15:76515083-76515105
Sequence CCAAAAACAGTAAAATTATAAGC AATTATAAGCTACAGTTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 604} {0: 1, 1: 0, 2: 1, 3: 18, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!