ID: 1129597915_1129597923

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1129597915 1129597923
Species Human (GRCh38) Human (GRCh38)
Location 15:76979345-76979367 15:76979369-76979391
Sequence CCGCACCATGTCCTGCTTGGCCT CCGCAGGGCGGCCTCCAGCTCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 17, 3: 50, 4: 309} {0: 1, 1: 7, 2: 18, 3: 29, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!