ID: 1129597916_1129597924

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1129597916 1129597924
Species Human (GRCh38) Human (GRCh38)
Location 15:76979350-76979372 15:76979378-76979400
Sequence CCATGTCCTGCTTGGCCTGCCGC GGCCTCCAGCTCGGACAACTTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 24, 3: 43, 4: 301} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!