ID: 1129600678_1129600691

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1129600678 1129600691
Species Human (GRCh38) Human (GRCh38)
Location 15:76996487-76996509 15:76996537-76996559
Sequence CCAACCCCGAAGAGGACGCTCTG GCCAACAGCCCTGCCCTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74} {0: 1, 1: 1, 2: 9, 3: 83, 4: 590}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!