ID: 1129628454_1129628456

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1129628454 1129628456
Species Human (GRCh38) Human (GRCh38)
Location 15:77230877-77230899 15:77230924-77230946
Sequence CCAGTAAGAAGCATAATTTGGTT GAAGTAAAAACCAAAAATTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 152} {0: 1, 1: 0, 2: 1, 3: 72, 4: 667}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!