ID: 1129674073_1129674085

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1129674073 1129674085
Species Human (GRCh38) Human (GRCh38)
Location 15:77622915-77622937 15:77622968-77622990
Sequence CCGGCCACCCTCTGCCCACACTG TTCTGCGGCCTCCTCTCCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 77, 4: 655} {0: 1, 1: 0, 2: 2, 3: 27, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!