ID: 1129674670_1129674679

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1129674670 1129674679
Species Human (GRCh38) Human (GRCh38)
Location 15:77626065-77626087 15:77626108-77626130
Sequence CCAAAGGCATAACACCCTTAGAG ACTGAGGCCCAGGAGCATCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 125} {0: 1, 1: 1, 2: 3, 3: 29, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!