ID: 1129683930_1129683933

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1129683930 1129683933
Species Human (GRCh38) Human (GRCh38)
Location 15:77674096-77674118 15:77674115-77674137
Sequence CCCATCTCCATCTATGGCAACCC ACCCCACCCTCCTAGATGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152} {0: 1, 1: 0, 2: 1, 3: 30, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!