ID: 1129692675_1129692680

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1129692675 1129692680
Species Human (GRCh38) Human (GRCh38)
Location 15:77722734-77722756 15:77722753-77722775
Sequence CCTGGTGGTGGTGGAGAGTGCGT GCGTGGGTGTAGAGGAAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 232} {0: 1, 1: 0, 2: 1, 3: 30, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!