ID: 1129696267_1129696272

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1129696267 1129696272
Species Human (GRCh38) Human (GRCh38)
Location 15:77742155-77742177 15:77742172-77742194
Sequence CCCACAAGCCTAGCTCAGACTGG GACTGGGCCAGAGAAGCTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119} {0: 1, 1: 0, 2: 0, 3: 20, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!