ID: 1129725139_1129725149

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1129725139 1129725149
Species Human (GRCh38) Human (GRCh38)
Location 15:77897827-77897849 15:77897872-77897894
Sequence CCGCAGCACAGGGCTGCACCTGG CTTGCCCGCCAACCTGTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 2, 3: 45, 4: 392} {0: 1, 1: 1, 2: 6, 3: 6, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!