ID: 1129743173_1129743183

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1129743173 1129743183
Species Human (GRCh38) Human (GRCh38)
Location 15:78000095-78000117 15:78000138-78000160
Sequence CCCTTGCAGTCTTGATAACAGCG GCACTCCTTAAAGCACCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 72} {0: 1, 1: 1, 2: 0, 3: 34, 4: 1226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!