ID: 1129750355_1129750357

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1129750355 1129750357
Species Human (GRCh38) Human (GRCh38)
Location 15:78058650-78058672 15:78058666-78058688
Sequence CCAGGACCACACAGCATTCACCA TTCACCAAAGACACGCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 397} {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!