ID: 1129760510_1129760518

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1129760510 1129760518
Species Human (GRCh38) Human (GRCh38)
Location 15:78126572-78126594 15:78126625-78126647
Sequence CCAGCCACTCCATGTCCTGCGTC GGTGCTTAATACAGGCTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 177} {0: 1, 1: 0, 2: 2, 3: 21, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!