ID: 1129776371_1129776379

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1129776371 1129776379
Species Human (GRCh38) Human (GRCh38)
Location 15:78239283-78239305 15:78239329-78239351
Sequence CCTGCCGGATCCAGACGGATGGC CGGCAAACAGCAGTGGTGGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 72, 4: 178} {0: 62, 1: 126, 2: 64, 3: 58, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!