ID: 1129780188_1129780191

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1129780188 1129780191
Species Human (GRCh38) Human (GRCh38)
Location 15:78264751-78264773 15:78264776-78264798
Sequence CCGCAGACACAAGATGGTGAAGG ACCCAGTACTATGACATCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 205} {0: 1, 1: 0, 2: 0, 3: 2, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!