ID: 1129810815_1129810826

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1129810815 1129810826
Species Human (GRCh38) Human (GRCh38)
Location 15:78508187-78508209 15:78508226-78508248
Sequence CCACCTTTCTGTTTCATGATCCC CCCGTGAGTCTGTGGAATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 361} {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!