ID: 1129830379_1129830380

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1129830379 1129830380
Species Human (GRCh38) Human (GRCh38)
Location 15:78665700-78665722 15:78665719-78665741
Sequence CCTTGAAGACATTATGCATGTGA GTGAAGTAAGCCAGTAACAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 36, 4: 259} {0: 1, 1: 5, 2: 39, 3: 197, 4: 569}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!