ID: 1129834490_1129834498

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1129834490 1129834498
Species Human (GRCh38) Human (GRCh38)
Location 15:78693505-78693527 15:78693536-78693558
Sequence CCTCTGGGATGAGCTCACTCCCC CAATTACTATCTATGGCTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 188} {0: 1, 1: 1, 2: 1, 3: 4, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!