ID: 1129834654_1129834660

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1129834654 1129834660
Species Human (GRCh38) Human (GRCh38)
Location 15:78694545-78694567 15:78694598-78694620
Sequence CCAAGACCAGGAACACTGAGCTG AGATTCTGATTCAGTGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 207} {0: 1, 1: 8, 2: 30, 3: 199, 4: 906}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!