ID: 1129849016_1129849025

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1129849016 1129849025
Species Human (GRCh38) Human (GRCh38)
Location 15:78781223-78781245 15:78781264-78781286
Sequence CCAACCTGCTTGGGTGGGGCCCA ATCCCCAGCAAGGAGACCAAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 23, 4: 193} {0: 1, 1: 0, 2: 1, 3: 21, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!