ID: 1129850597_1129850602

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1129850597 1129850602
Species Human (GRCh38) Human (GRCh38)
Location 15:78791479-78791501 15:78791496-78791518
Sequence CCTTCCCAGAGTTGCAGCCTCTC CCTCTCCTGAGCCTCAGTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 273} {0: 1, 1: 1, 2: 1, 3: 23, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!