|
Left Crispr |
Right Crispr |
Crispr ID |
1129860631 |
1129860637 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
15:78858309-78858331
|
15:78858339-78858361
|
Sequence |
CCAGGCACTGTGGCTCACACATG |
GGTTCTTTTGGAGGCCGAGGCGG |
Strand |
- |
+ |
Off-target summary |
{0: 4, 1: 507, 2: 13888, 3: 54191, 4: 125623} |
{0: 1, 1: 3, 2: 128, 3: 5367, 4: 109843} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|