ID: 1129860631_1129860637

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1129860631 1129860637
Species Human (GRCh38) Human (GRCh38)
Location 15:78858309-78858331 15:78858339-78858361
Sequence CCAGGCACTGTGGCTCACACATG GGTTCTTTTGGAGGCCGAGGCGG
Strand - +
Off-target summary {0: 4, 1: 507, 2: 13888, 3: 54191, 4: 125623} {0: 1, 1: 3, 2: 128, 3: 5367, 4: 109843}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!