ID: 1129921127_1129921131

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1129921127 1129921131
Species Human (GRCh38) Human (GRCh38)
Location 15:79319972-79319994 15:79320001-79320023
Sequence CCGGATAACTGCGGGTGGGCCTG GTCAGGCCCTCCACAAGAGGTGG
Strand - +
Off-target summary {0: 13, 1: 35, 2: 63, 3: 139, 4: 184} {0: 177, 1: 128, 2: 50, 3: 45, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!