ID: 1129935028_1129935035

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1129935028 1129935035
Species Human (GRCh38) Human (GRCh38)
Location 15:79440217-79440239 15:79440248-79440270
Sequence CCCCCATATTTTACAAGGCTGTT CCCGCATAAGGAGAAGATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 195} {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!